...
You can also use algorithms and instruments from the context menu or the toolbar.
Example 1: Finding patterns in your sequence. Do the following steps:
Open the ugene/data/samples/murine.gb by File–>Open menu, for example. Sequence View with murine.gb opens.
Select the Search in Sequence tab of the Options Panel. Click Show more options and more options appear. Insert, for example "TTCCGAGGGACACTAGGCTGACTCCATC" pattern into Search for: field and choose annototation parameters. For example as in the picture below:
HTML |
---|
<center>
<img src="/wiki/download/attachments/2883698/search_pattern_settings.gif"/>
</center> |
After that click the Search button. The pattern appears:
...
Select the Analyze-->Find ORFs item from the context menu:
HTML |
---|
<center> <img src="/wiki/download/attachments/2523429/pic6.png"/> </center> |
...