Child pages
  • View, edit and annotate DNA, RNA and protein sequences

Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.

...

Open the ugene/data/samples/murine.gb by File–>Open menu, for example. Sequence View with murine.gb opens. Select the Search in Sequence tab of the Options Panel. Click Show more options and more options appear. Insert, for example "TTCCGAGGGACACTAGGCTGACTCCATC" pattern into Search for: field and choose annototation parameters. For example as in the picture below:

HTML
<center>
  <img src="/wiki/download/attachments/2883698/search_pattern_settings.gif"/>
</center>

...