Unipro UGENE User Manual
Page tree

Versions Compared

Old Version 1

changes.mady.by.user Yuliya Algaer

Saved on

compared with

New Version Current

changes.mady.by.user Svetlana Samoilenko

Saved on

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.

...

  1. Input DNA Sequences: On this page you must input DNA sequences. 

    HTML
    <center>
  <br>
  <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_1.png"/>
  <br> 
</center>

  2. Primers and Parameters: Here you must input Primers and you can optionally modify In Silico PCR parameters.

    HTML
    <center>
  <br>
  <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_2.png"/>
  <br> 
</center>

    The following parameters are available:

    Primers URLA URL to the input file with primer pairs.
    MismatchesNumber of allowed mismatches.
    Min perfect matchNumber of bases that match exactly on 3' end of primers.
    Max product sizeMaximum size of amplified region.
    Use ambiguous basesSearch for ambiguous bases (as "N") if checked.

    The input primers file should be in the FASTA format and contain an even number of primers (because each pair should have forward and reverse primers). 

    Example format:
    >forward
    CTTGTATGAATGGCCGCACG
    >reverse
    GATGTAGCGGGTCGTAGTGG


  3. Output data: Here you can see information about output data.

    HTML
    <center>
  <br>
  <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_3.png"/>
  <br> 
</center>