This workflow simulates the PCR process.
If you haven't used the workflow samples in UGENE before, look at the "How to Use Sample Workflows" section of the documentation. |
The workflow sample "In Silico PCR" can be found in the "Scenarios" section of the Workflow Designer samples.
The opened workflow looks as follows:
<center> <br> <img src="/wiki/download/attachments/16123482/In Silico PCR Sample.png"/> <br> </center> |
The wizard has 3 pages.
Input DNA Sequences: On this page you must input DNA sequences.
<center> <br> <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_1.png"/> <br> </center> |
Primers and Parameters: Here you must input Primers and you can optionally modify In Silico PCR parameters.
<center> <br> <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_2.png"/> <br> </center> |
The following parameters are available:
Primers URL | A URL to the input file with primer pairs. |
Mismatches | Number of allowed mismatches. |
Min perfect match | Number of bases that match exactly on 3' end of primers. |
Max product size | Maximum size of amplified region. |
Use ambiguous bases | Search for ambiguous bases (as "N") if checked. |
The input primers file should be in the FASTA format and contain an even number of primers (because each pair should have forward and reverse primers).
Example format:
>forward
CTTGTATGAATGGCCGCACG
>reverse
GATGTAGCGGGTCGTAGTGG
Output data: Here you can see information about output data.
<center> <br> <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_3.png"/> <br> </center> |