...
Input DNA Sequences: On this page you must input DNA sequences.
HTML <center> <br> <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_1.png"/> <br> </center>
Primers and Parameters: Here you must input Primers and you can optionally modify In Silico PCR parameters.
HTML <center> <br> <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_2.png"/> <br> </center>
The following parameters are available:
Primers URL A URL to the input file with primer pairs. Mismatches Number of allowed mismatches. Min perfect match Number of bases that match exactly on 3' end of primers. Max product size Maximum size of amplified region. Use ambiguous bases Search for ambiguous bases (as "N") if checked. The input primers file should be in the FASTA format and contain an even number of primers (because each pair should have forward and reverse primers).
Example format:
>forward
CTTGTATGAATGGCCGCACG
>reverse
GATGTAGCGGGTCGTAGTGGOutput data: Here you can see information about output data.
HTML <center> <br> <img src="/wiki/download/attachments/16123482/In Silico PCR Sample_3.png"/> <br> </center>